Day 130 – Get a DNA reading

So I called the hospital and some guy told me that to get a DNA reading it costs a lot of money and takes a lot of time. Bummer. So here’s my made up DNA reading:

GATCTCTAGGATATCTAGCATGCATTCATCGAGCGATCTATCGACTGACTGATCGACTTTT
AGCGACGGACGTTCGCGAGCGAGCTATACTCATCGCTGCTCGTATATATCTACGATCGA
TCGATCGATCGTACGTATCGATCGATCGATCGTATCGACTAGCTAAAAGATCGATCGAT
CGATGTCATCGATCGATCGGCGATCTATATCATCGCGATCTACTAGCGTGACGCGCTATA
TATCGGACGATGCTGTACGACACTGATCGATCGATCGACTGA ETC…..

Points earned: 2
Total points: 337

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s


%d bloggers like this: